yaaT [2019-09-20 18:05:55]

subunit of the regulatory iron-sulfur containing YmcA-YlbF-YaaT complex, required for RNase Y dependent maturation of polycistronic mRNAs, control of the phosphorelay, required for the achieving a sufficient level of Spo0A-P for sporulation initiation

Locus: BSU_00320

Isoelectric point: 4.84

Molecular weight: 31.07 kDa

Protein length: 275 aa

Gene length: 828 bp

Function: control of RNase Y activity, see Targets of the Y complex

Product: subunit of the regulatory iron-sulfur containing YmcA-YlbF-YaaT complex

Essential: no

Synonyms: ricT

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → RNA synthesis and degradation → RNases → Effectors of RNA degradation
• Information processing → Regulation of gene expression → phosphorelay
• Information processing → Regulation of gene expression → phosphorelay → Other protein controlling the activity of the phosphorelay
• Lifestyles → Sporulation → phosphorelay
• Lifestyles → Sporulation → phosphorelay → Other protein controlling the activity of the phosphorelay

Gene

Coordinates: 41,657 → 42,484

Phenotypes of a mutant

• block of sporulation at stage 0 PubMed
• strongly reduced genetic competence, strongly reduced sporulation PubMed
• defective in RNase Y-mediated maturation of polycistronic mRNAs, see Targets of the Y complex PubMed

The protein

Catalyzed reaction/ biological activity

• the YmcA-YlbF-YaaT complex acts as specificity factor for RNase Y-dependent processing of polycistronic mRNAs, see Targets of the Y complex PubMed
• the YmcA-YlbF-YaaT complex stimulates Spo0A phosphorylation in the phosphorelay PubMed

Domains

• PSP1 C-terminal domain (aa 61-146) (according to UniProt)

Cofactors

• two 4Fe-4S clusters PubMed

Localization

• cytoplasm PubMed
• cell periphery, depending on RNase Y PubMed

Expression and Regulation

Operons

• Genes: xpaC-yaaN-yaaO-tmk-darA-yaaR-holB-yaaT-yabA-trmN6-yazA-yabC
  Description: PubMed

• Genes: darA-yaaR-holB-yaaT-yabA-trmN6-yazA-yabC
  Description: PubMed

  Regulation

  • expressed during growth and the transition phase, expression is erduced in stationary phase PubMed

• Genes: tmk-darA-yaaR-holB-yaaT-yabA-trmN6-yazA-yabC
  Description: PubMed

Additional information

• 600,000/ 11,500 molecules per cell during growth in LB/ minimal medium PubMed

Biological materials

Mutant

• MGNA-B899 (ricT::erm), available at the NBRP B. subtilis, Japan
• BKE00320 (ΔyaaT::erm trpC2) available at BGSC and in Jörg Stülke's lab, PubMed, upstream reverse: _UP1_GACACCAATTACATTGTACA, downstream forward: _UP4_ACAGATTAACGAGGTGTGGA
• BKK00320 (ΔyaaT::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GACACCAATTACATTGTACA, downstream forward: _UP4_ACAGATTAACGAGGTGTGGA

References

Loading